SimpleSearch - Line and FST details


Line specific information

 
Line ID 187H05
Vector Used pAC161
Line Availability only available from NASC (N417945)
Segregation Analysis 50:49:34
Confirmed for Hit At5g07420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g07420

 
Sequence (A. th genome BLAST matches underlined)
>40-K014619-022-187-H05-8409
TTGATCCATGTAGATTGTCCCGGACATGAACGCCTTTACAATTGAATATGAGAATAAATT
GATTATGGTTTTACTTTTTTTTTTTTACCCCCCCAAAACCCCCTTTCCGGAATTTAAGCC
CCACCGGTTAAAAGATTTTAAATTGGGCCATTTTTTAACAGGGTTTTTTTGCCCAAAAAC
CAAAACCGGGTTCCAACCC
GenBank Accession AL759507 [GenBank]
Graphic View Graphic view of gene At5g07420
Predicted Position of Insertion Chr5:2349942 - go to primer design
BLAST e Value 1e-04
Hit Clone Code (BAC ID) T2I1
Hit Gene Code At5g07420 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pectin lyase-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23