SimpleSearch - Line and FST details


Line specific information

 
Line ID 189F10
Vector Used pAC161
Line Availability available as T3 set from NASC (N418118)
Segregation Analysis 100:95:66
Confirmed for Hit At5g42910
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g42910

 
Sequence (A. th genome BLAST matches underlined) 
>78-K014625-022-189-F10-8409
CAAGCGAAGCCATAACATGGTCACCGGTTACCCCATTTCCAACATTAAATGGGAAACAAA
AGATTAACGGCGAGTCTTCATTACTCTCACCATCTCCATACATTACGCAACGGCACCACT
ACCCCACGAAGCGCCACCCCCTAATATCTAAAACCCATCA
GenBank Accession BX890869 [GenBank]
Graphic View Graphic view of gene At5g42910
Predicted Position of Insertion Chr5:17204552 - go to primer design
BLAST e Value 3e-45
Hit Clone Code (BAC ID) MBD2
Hit Gene Code At5g42910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Basic-leucine zipper (bZIP) transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37