SimpleSearch - Line and FST details


Line specific information

 
Line ID 190B06
Vector Used pAC161
Line Availability only available from NASC (N418162)
Segregation Analysis 100:98:73
Confirmed for Hit At4g10960
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g10960

 
Sequence (A. th genome BLAST matches underlined)
>42-K014640-022-190-B06-8409
CTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGATGAA
GCCATATGTAGATTTCTCCATATTCCACCACGTGGCATTTTCATTATTCCATTCCCTTAA
TTGAAAACGTAATAATACATGGCGTTTTTAAATTAAGCCTAAGTTTAATGTAACCATATT
ATTCACGTAACCATCACCGATTCTATATATTAAAAACCTCCAAGCACTCTTTCGCTGGAG
ATCACAAAGCAATCTAAAAACATTTCTCTTGATCTTTTTCCTTTACCAAAAAACAAAGAT
CCTTTCTTCTGTTTCGTAATGATGGCTAGTGGGATCCTC
GenBank Accession CR356284 [GenBank]
Graphic View Graphic view of gene At4g10960
Predicted Position of Insertion Chr4:6718731 - go to primer design
BLAST e Value 2e-135
Hit Clone Code (BAC ID) F25I24
Hit Gene Code At4g10960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-D-glucose/UDP-D-galactose 4-epimerase 5
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences


Last Updated on 31.08.2016 09:40