SimpleSearch - Line and FST details


Line specific information

 
Line ID 191A08
Vector Used pAC161
Line Availability only available from NASC (N418248)
Segregation Analysis 50:45:32
Confirmed for Hit At1g21600
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g21600

 
Sequence (A. th genome BLAST matches underlined)
>57-K014642-022-191-A08-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTTGCACG
ATCTACATGGCTTATATGAGCTTGAATACTGATAGATGCCTTGATTTCGCCATTCCGCAG
ATACCCATTTCATGCTTCAGATTGGGCTGAGATTATGCGAAAATATACACTCATATACAT
AAATACTGACAGTTTGAGCTACCAATTCAGTGTAGCCACATTACCTTACATAATTCACTC
AGATGCTATGGGATCCTCCCATTAGAGAGAGATGTCGAGTATGACCCCTTGGCCGCCGCG
ATAGCCGCTGCAGGCGGTGGTGGTGATGGAGATATCGCTTTTGATCAGAGTAAGAGTTTT
ATATCGACACAAGGATGGGATTCGGATATGGTGGTTGATTATCGGATAAACGAAGATGAG
TTTCATAAACTCAGCTTAATGGACTGTGATTTCTTTATCAGAAAACCTCCTGATCCAGAT
AATGATGTTTATGATTTCAGAGAGGTGTGTGAATTCCCAGTGACTCTAATTGCTCATTTC
TTCGATTTCTCTATGGGATCCTCCATGAGGGGGAGGGNCCCCCCCC
GenBank Accession AL759802 [GenBank]
Graphic View Graphic view of gene At1g21600
Predicted Position of Insertion Chr1:7573742 - go to primer design
BLAST e Value 2e-156
Hit Clone Code (BAC ID) F24J8
Hit Gene Code At1g21600 [TAIR] [MIPS] [SIGnAL]
Gene Annotation plastid transcriptionally active 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23