SimpleSearch - Line and FST details


Line specific information

 
Line ID 191D05
Vector Used pAC161
Line Availability only available from NASC (N418281)
Segregation Analysis 100:70:49
Confirmed for Hit At2g36060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g36060

 
Sequence (A. th genome BLAST matches underlined)
>36-K014644-022-191-D05-8409
CTGATCCATGGTAGATTTCCCGGACCATGAAGCCTGTAGAGTAATTCAACTGCCCCAAAT
TGCTCTCGACTTTTTATTCTCGGATTAGCGTTTGTGCTTTCGCATCAGAGAATCTCTCAG
TTCTTCTCAATTTAGGTCATCAGATCTCACAATCAATCGACTCGAACTCAAATCTCACTT
CATCAATCAAATCATGACTCTTGGCTCAGGATCGAGTGTTGTCGGTAAATTTTCGATTTT
TTTTTTTTGGGTCCCTTTTAAAGTTCCCTAGGGGACCCCCCTTAAGGGGGGGGNNNNNNN
NNNNNNNNNNTNNNNTTTTTNNTNNNANNTNNAAANGNNNAAAGGGGNAANNNNNNNATA
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNN
NNNNNNNNANNNNNNNANNNANNNNNNNNNANNANNNNNAAAAAANNNNAANNNNNAAAA
NNNNNNNNNAAAAAAAAAAAAANCCCCNNANNANANANNNANNANAAANNNNANNNNAAA
AATTAAANNNNNNATAAATTAAAAANAANAAATTAAATTNNANNNTNNNTANNNNATNNT
TTTTTTTTTTTNTNTTATNNNNNNTTTATATTTATTNTNNNCCCCAANANNANNNANTAN
NTTTTATAAATTANNATTATTATTTTNNNNAAAAAAAANNNNATANTTTTAAAAATAANN
ATTTTTATATATACCTAAATANNNTAATTAAAAATAATATTTA
GenBank Accession AL759839 [GenBank]
Graphic View Graphic view of gene At2g36060
Predicted Position of Insertion Chr2:15144155 - go to primer design
BLAST e Value 3e-109
Hit Clone Code (BAC ID) F11F19
Hit Gene Code At2g36060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MMS ZWEI homologue 3
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR770273 [GenBank] AL759838 [GenBank] AL759838 [GenBank]


Last Updated on 31.08.2016 09:40