SimpleSearch - Line and FST details


Line specific information

 
Line ID 191H09
Vector Used pAC161
Line Availability only available from NASC (N418333)
Segregation Analysis 100:99:77
Confirmed for Hit At3g61880
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g61880

 
Sequence (A. th genome BLAST matches underlined)
>72-K014644-022-191-H09-8409
NTGATCCATGTAGATTNTCCCGGACCATGAAGCCTTTACAATTGAATTGTTCCTGCATTG
ATACTGTGGGATCTGATCTTGACTCCATATGTGACAAGACATAAGCCCAATTTATTTGAG
GAAATATTGAAATACACGCAAGGCCTTGCAGGCCCAATAAAAAAAGCAGATTAAACGCCA
CGATTTAATTTGCTTATTTATTACACCCCCCTATGGGATGCTCCCTATTAGTAGAGTTTT
GAACTAATTACAAAAACTAACAAGAGGGGCTTCTAATGTTTTTTTCTATATAAATACCTG
AAGCCTTTCGTCTTAAACCCCACAGCAAAAAGCCACTCTCCTTTCTCTCTCTCTCTTGTT
CCTCTGCATCCATGGCCACCAAGCTCGACACCAGTAGCTTACTTTTGGCCCTCTTGTCCA
AATGTAGCCTCCTTACTCAAACCAATCTTGCTCTCTCTCTCCTCGTAGCCTCCCTATGGG
ATCCTCC
GenBank Accession CT026166 [GenBank]
Graphic View Graphic view of gene At3g61880
Predicted Position of Insertion Chr3:22908203 - go to primer design
BLAST e Value 3e-97
Hit Clone Code (BAC ID) F21F14
Hit Gene Code At3g61880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome p450 78a9
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX530816 [GenBank] AL759899 [GenBank]


Last Updated on 07.07.2016 14:03