SimpleSearch - Line and FST details


Line specific information

 
Line ID 192C04
Vector Used pAC161
Line Availability only available from NASC (N418364)
Segregation Analysis 50:47:46
Confirmed for Hit T22F11
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T22F11

 
Sequence (A. th genome BLAST matches underlined)
>27-K014647-022-192-C04-8409
TGATCCATGTAGATTTCCCGAACGTCGAAACCGTTACTGGACTAATATGCGCTCTCTCCT
CTTTATTAATTGTCGCCGGGGATCATGGGGATCCTCCATTNAGTAGATGTACTTCTTCTT
TGTTTTGTTTTCTAAATTACACAGAAATTTGAGTTTGATGAAATAAAAAAGAGCTACCGT
GCGCTATGGGATCCTCCCTATTAGTGAG
GenBank Accession AL759938 [GenBank]
Graphic View Graphic view of sequence AL759938 of line 192C04
Predicted Position of Insertion Chr2:10806110 - go to primer design
BLAST e Value 9e-36
Hit Clone Code (BAC ID) T22F11
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23