SimpleSearch - Line and FST details


Line specific information

 
Line ID 192F07
Vector Used pAC161
Line Availability only available from NASC (N418403)
Segregation Analysis 50:49:47
Confirmed for Hit At3g05260
Parent of DUPLO pair 2335
Parent of pair(s) none

Gene hit At3g05260

 
Sequence (A. th genome BLAST matches underlined)
>54-K014647-022-192-F07-8409
CTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGCCATTTTCCTATTTTC
CTTTCAGAGTATTCGAAAATTTCCGGGAAAGGTTTTGGTTATTGGCGACCGAGAAAATTA
CCGTAGAGATCGACAGAAACAAATAAGATAAAGAAGGTGTCAAAAAGTGAGAGCTTCTTT
GAGTGACGTGCCACGTTGCATCTCAATTTAGATGACGTGTACAAGCCATTGCAACGGTGC
AGCCAGGGAGGAGTCCACGTGGGGAAAATCAGCTTATTTGGGATAACCGCTATGGGATCC
TC
GenBank Accession AL759974 [GenBank]
Graphic View Graphic view of gene At3g05260
Predicted Position of Insertion Chr3:1498913 - go to primer design
BLAST e Value 3e-137
Hit Clone Code (BAC ID) T12H1
Hit Gene Code At3g05260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40