SimpleSearch - Line and FST details


Line specific information

 
Line ID 192F11
Vector Used pAC161
Line Availability only available from NASC (N418407)
Segregation Analysis 50:50:40
Confirmed for Hit At1g05805
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g05805

 
Sequence (A. th genome BLAST matches underlined)
>86-K014647-022-192-F11-8409
GTGATCCATGTAGATTNTCCCGGACATGAAAGCCTTTACAATTGAATATATCAAATGGTA
TTTTCGTTTGCCTAAATATCAAAGCTCACAATGTCAACTTATTTTATATACATAGTCGTT
AATTAACTTGTAAGAAACTATATAGCTTCTCAGTGAGAAATACCGAAAATACCCTCGTGG
TTAGATTTTCATTTCACCAAAAAACGGATCTTTAGTTGAGCAATGAATGATTGAATGACT
GAAAACTATATAGCTCATATTCTACATTACGATTTTTGGCAAATTCTAAGGAAAAATGGT
CTGAAAATGAGTAAACAATGTCTGTCTAAATATATATATCTCATCACAGTTACTATTCTT
GAGTAAAAAAAGGACTAACTGTTTTTATCTGAGGCGAGGTAGGTGAAGAAATCGGCGGGA
GAGCTACGTTGGCTATGGGATCCT
GenBank Accession AL759979 [GenBank]
Graphic View Graphic view of gene At1g05805
Predicted Position of Insertion Chr1:1745636 - go to primer design
BLAST e Value 5e-176
Hit Clone Code (BAC ID) T20M3
Hit Gene Code At1g05805 [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23