SimpleSearch - Line and FST details


Line specific information

 
Line ID 193A08
Vector Used pAC161
Line Availability only available from NASC (N418440)
Segregation Analysis 100:93:83
Confirmed for Hit At2g18480
Parent of DUPLO pair none
Parent of pair(s) 730, 3749, 11180, 78465, 78467
Note Although the line exists, the insertion in At2g36060 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g36060

 
Sequence (A. th genome BLAST matches underlined)
>41-K020163-022-193-A08t-8409
AGAATCATGACTCTTGGCTCAGGATCGAGTGTTGTCGGTAAATTTTCGATTTTTTTTTTT
TGGGTCCCTTTTAAATTTCCCTTGGGAACCCCC
GenBank Accession BX530818 [GenBank]
Graphic View Graphic view of gene At2g36060
Predicted Position of Insertion Chr2:15144131 - go to primer design
BLAST e Value 8e-18
Hit Clone Code (BAC ID) F11F19
Hit Gene Code At2g36060 [TAIR] [MIPS] [SIGnAL]
Gene Annotation MMS ZWEI homologue 3
Insertion Classification TS2TE (5')
Confirmation Status failed, line belongs to a contamination group, please check line 191D05

Gene hit F21A14

 
Sequence (A. th genome BLAST matches underlined)
>57-K014650-022-193-A08-8409
NTGATCCATGTAGCATTTCCCGGACATGAANGCCTTTACAACCGAGGAATCGTCCACCAC
GACGGTAGACTGGTCGATTGAACATCTATCGGGTTCGAGGAATGGTCGACCAGGGGTTGA
AATCGTCGACCGGGTCCGAGACTTCATCGACCGTGACCGAGGATTGGTCGACCATGATTT
GAAATCATCGACCGGGACCGAGAATTCGTCGACCAGGACGGCGGAATGCTCGACCAGGAC
GATGAATGGGCGATGAAAATCTATCGGGTTATAGGAATGGTCGACCAGAAGTTGGAATCG
TCGACCGGGTCCGAGAATTCGTCGACCAGGACCAGGAGTGGTCGAGGATTTGTCGACCGG
GAGTTGAAATCGTCGACCGGGTCCGAGAATTCGTCGACCAAGACGGCGGAACCCTCGACC
AGGACGATGAATGGGCGATGAAAATCTATCGGGTTCGAGGAATGGTCCGACCAGAAGTTG
AAATGGTCGACCGGGTCCAAGAATTCGTCGACCAGGCCCAGGAGTGGTCGAGGATTTGCC
GACCAGGAGTTGACATCGTCCACCGGGCGCGGAGATTTCGTGGACCAGGACGGGGGGACC
CT
GenBank Accession AL760023 [GenBank]
Graphic View Graphic view of sequence AL760023 of line 193A08
Predicted Position of Insertion Chr3:14192114 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F21A14
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g18480

 
Sequence (A. th genome BLAST matches underlined)
>57-K014649-022-193-A08-8409
TTTTGATCCATGTAGATTTCCCGGACGTGAAGCACTTTACAATCGATCTTGCTCGCGGCC
GTTGGGATACACTTTTTCGAGCATGCGACGGGGATTGAGGCCGTCGTGCTGTACAGCCCG
AGAATTTTCAAGAAAGCCGGAGTTGTTTCGAAAGACAAGCTCTTGCTATGGGATCCTCCC
TATAGAGAGACCGGCACCGAGAATTCGTCTACCACGACGGTGGAATGCTCGACCAGGACG
ACGAATGGGCGATGAAAATCTATC
GenBank Accession AL760022 [GenBank]
Graphic View Graphic view of gene At2g18480
Predicted Position of Insertion Chr2:8010272 - go to primer design
BLAST e Value 3e-54
Hit Clone Code (BAC ID) T30D6
Hit Gene Code At2g18480 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR396308 [GenBank]


Last Updated on 14.10.2014 10:23