SimpleSearch - Line and FST details


Line specific information

 
Line ID 193B03
Vector Used pAC161
Line Availability only available from NASC (N418447)
Segregation Analysis 100:92:83
Confirmed for Hit At4g01720
Parent of DUPLO pair none
Parent of pair(s) 1463

Gene hit At1g55020

 
Sequence (A. th genome BLAST matches underlined)
>18-K014650-022-193-B03-8409
CTGATCCATGTAGAATTTCCCGGACATGAANGCATTTACAATTGAATATATATGTATTAC
CTCTTTTTAAGTTCTGCTGGTAATGCTTGGTCAGGGAAGGTCCAGTGGTTTTTGTAAATG
AAAGATGACATCTCCATGGCGTATTTAGAAGGAAACACAGTGATTTCAAATATACCACCA
CCATTGATCAAGATTTGCCTATGGGATCCTCCC
GenBank Accession AL760030 [GenBank]
Graphic View Graphic view of gene At1g55020
Predicted Position of Insertion Chr1:20529303 - go to primer design
BLAST e Value 2e-80
Hit Clone Code (BAC ID) F14C21
Hit Gene Code At1g55020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation lipoxygenase 1
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At4g01720

 
Sequence (A. th genome BLAST matches underlined)
>18-K014649-022-193-B03-8409
NTGATCCATGTAGATTNTCCCGGNACATGAAGCCTTTACAATTGAATATATCCTGAAATC
TACATTTGGTAGTCCCAATATGCATTTTTGAAGCCAATTTGAAGTTGGAGCTATGGGATC
CTCCCTATAGTGAGCACAAACTGAAGCATTTATTACATGAGGTCTGTGAGAGTTACAACG
ACCTCCAAAGAAAAGTTTTGTTAGCATGACAAACACAAGTGGAAGGTCTTCATCATAAAC
AACATGAGGTACTTGATAAAATCATAAAAATGATAATAAAATATATATCAACATTTCGGT
TTATTAAAAAATAAATTGTATATTTGTCTTTTTTATGTGGCACCGAGATTAGCTTAAGTT
TTAGTGTTCGATTTATCTGGTTTTGAAAATTTAAAGGGATCTATTAGTTTTGTTTTTCTC
GAAAGCAATTAAAATTTATAACTATGTGTAATATGCGTAAATAATGGATGTAGTTTAGCT
ACTGAATGAATTCATAATTCTCATCCTAAATGCCCCGATGGAAAGGACTAGAACGAATAA
AAACCTGCCGCTTTTTTTTGATCAAACTCGAAGAAGCGAAATAAATAGCTTTGGGAACCT
CCTAAGAATAGGGGNNGGCNNAAGGGCGTCCGGGGGGTGGGCCGCGCCCAGCACCCCCGG
GGCCGCGGGCCTCCCCAATTGACTCACCCGGGAGGTCCCCG
GenBank Accession BX572214 [GenBank]
Graphic View Graphic view of gene At4g01720
Predicted Position of Insertion Chr4:745685 - go to primer design
BLAST e Value 2e-80
Hit Clone Code (BAC ID) T15B16
Hit Gene Code At4g01720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY family transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40