SimpleSearch - Line and FST details


Line specific information

 
Line ID 194C07
Vector Used pAC161
Line Availability only available from NASC (N418559)
Segregation Analysis 50:50:44
Confirmed for Hit At5g19330
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g19330

 
Sequence (A. th genome BLAST matches underlined)
>51-K014694-022-194-C07-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATAAAAATAAATAAAGGGTTTT
TATTTGTGAGTCGAATGAAATAACGAAAATACCCCTGATCTCTTTTGTGCCTGAGATTGA
TTTCAAAACGCTGCTTCTTCTTCTTCTCTGATCTCTCCTCTTCTTCGGATCGTCTTTTAC
TTTGTGAACGATGGACCAACAACCGGAGAGGCGAGAAGGCCGGAGTTTTCCGGAGCGTAA
AGGACAGAAGCGGAAGCTATGGGATCCTCCTATAGCCGAGAAANATCGAGAGATCTCTGC
CGTCAGCACCGACGGAGGCCAAGCGCTTCTTAGCGAGGTTGCTGCTCAAGTCTCGGTACT
AAACTCTGCCTTCTCTTGGCAAGAGTCCGATCGCGCTGCTGCCAAGCGAGCCACTCAAGT
TCTGGCTGAGCTATGGGATCCT
GenBank Accession AL760137 [GenBank]
Graphic View Graphic view of gene At5g19330
Predicted Position of Insertion Chr5:6512833 - go to primer design
BLAST e Value 6e-114
Hit Clone Code (BAC ID) F7K24
Hit Gene Code At5g19330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat protein interacting with ABF2
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03