SimpleSearch - Line and FST details


Line specific information

 
Line ID 196F07
Vector Used pAC161
Line Availability only available from NASC (N418787)
Segregation Analysis 50:46:35
Confirmed for Hit At1g69640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g69640

 
Sequence (A. th genome BLAST matches underlined)
>54-K014718-022-196-F07-8409
ATTTTGATCCATGTAGCCTTTCCTCGGACATGAAGCCTTTACAATTGAATATATCCCTGT
ATATTTCCCTAATACAATCCCCAATCATCGTTTCAATAATCGAATTTCCCCAATTGAAGA
ATAAAGATCAAAACTTTGGAAGTTTTCCTGTGAAAATAATCTATCCTTTTTGCATCATTT
GCGTTTTGGTTGATGAAGAGGATCTGAAGAAGCTGACATTTACGAATGATGATGGGTTTT
GCTGTATCGGATGAATTGTTGGGTACTGTTGCTCCGATTGTGGTGTACTGGTTGTATTCT
GGGATTTATGTAGCGCTCTCCTCTTTAGAGAGTTATAGATTGCATTCAAAGGTTGAAGAA
GAAGAGAAGAATCTTGTCTCGAAATCTTCTGTTGCGAAAGGTGTTCTTGTTCAACAGGTT
GTTCAAGCTGTTGTCGCTATCCTTTNGTTCACGGTACCGTTTTTCTCTTTTCCCATTTTT
GAGTTGTTTTGCTTTTGTGAAATTGAAGTGAAAAGTTAGGTAAAACATATTGGGGAATTT
TGATATCTGACGCTGACTTTTATTGTGTGGGAATTGGATGGTTAAGATTTTTTGTTTTTA
AAAGGTTAACTTTTTGGCTTGATGTTGTCTTTCGACCCATAAAGAGAAATGGGGTATGTA
TTAATGATCCTTAAGTGGATCATATTTGGACTGTTCTAACCATAGTTCAGAGCTGTAGAG
GAAAGTATCATAAGGGATTGGGTCTGTGAATAGGCAATAGGGTTTAAACTTGGCAGAC
GenBank Accession AL760360 [GenBank]
Graphic View Graphic view of gene At1g69640
Predicted Position of Insertion Chr1:26195633 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F24J1
Hit Gene Code At1g69640 [TAIR] [MIPS] [SIGnAL]
Gene Annotation sphingoid base hydroxylase 1
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL760359 [GenBank] HE664333 [GenBank]


Last Updated on 14.10.2014 10:23