SimpleSearch - Line and FST details


Line specific information

 
Line ID 198A02
Vector Used pAC161
Line Availability only available from NASC (N418914)
Segregation Analysis 50:43:31
Confirmed for Hit At1g56690
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g56690

 
Sequence (A. th genome BLAST matches underlined)
>09-K014762-022-198-A02-8409
NTGATCCATGTAGAATTTCCCGGACATGAAGCGTTGAGTGAATTGCAGTTTTGAGATCTC
ACGTCTCTCACGAATCGGGAAAATAATGAAGCACGAAAGTTTTTCGATTCGTTACAGTTT
AAAGCAATCGGTTCATGGAACTCAATTGTATCTGGGTATTTCTCAAACGGGTTACCGAAA
GAAGCACGCCAACTGTTCGACGAAATGTCTGAGAAAAATGTAGTTTCCTGGAACGAGGTT
GGTTTCAGGGTATATTAAGAATAGGATGATTGTAGAAGCTATGGGATC
GenBank Accession AL760482 [GenBank]
Graphic View Graphic view of gene At1g56690
Predicted Position of Insertion Chr1:21253866 - go to primer design
BLAST e Value 3e-125
Hit Clone Code (BAC ID) F25P12
Hit Gene Code At1g56690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR396311 [GenBank] AL760482 [GenBank]


Last Updated on 31.08.2016 09:40