SimpleSearch - Line and FST details


Line specific information

 
Line ID 198D04
Vector Used pAC161
Line Availability only available from NASC (N418952)
Segregation Analysis 100:95:59
Confirmed for Hit At4g38180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g38180

 
Sequence (A. th genome BLAST matches underlined)
>28-K014762-022-198-D04-8409
TTGAAAAGCACTACAAATGAAAGCCTCAGTTTCATTACTGATAAAGGCACAGCCGAAAAG
AATGGGTTGGCCATGGTGATTTACACCAGTGAAGGGTGCGAAAGGCAAACGGTACCTGTT
GGACCTGTAGGTTGTATCAAATGTAACGGTGTCTCCAAAGTGCGATAATATGACATTATG
ATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTAT
GATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGT
AGATGTCCGCAGCGTTATTATANNNN
GenBank Accession AL760496 [GenBank]
Graphic View Graphic view of gene At4g38180
Predicted Position of Insertion Chr4:17908362 - go to primer design
BLAST e Value 4e-72
Hit Clone Code (BAC ID) F20D10
Hit Gene Code At4g38180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FAR1-related sequence 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03