SimpleSearch - Line and FST details


Line specific information

 
Line ID 198D04
Vector Used pAC161
Line Availability only available from NASC (N418952)
Segregation Analysis 100:95:59
Confirmed for Hit At4g38180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g38180

 
Sequence (A. th genome BLAST matches underlined)
>28-K025984-022-198-D04-8409
CCTTTACATTGAATATATCATAATGTCATATTATCGCACTTTGGAGACACCGTTACATTT
GATACAACCTACAGGTCCAACAAGTATGGGATCCTCCCTATAGTGAGACCNATTACTCCT
GCCTTTTGTGACCCTCCTTTTCTTAAGATGCGATCCTCCCTATTATGAGACCATTTATAC
TCTCTCGTTTTGTTTTCTGACTGTGGCCATATTTCAGTGCGAGTTTCCCCTTTTAAGAGA
CTCCCCTCACGTAATCCCTCGTGTTATTTCACAATAGAAACCTCTATACCGTGGGCCTAT
ACATGCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR396354 [GenBank]
Graphic View Graphic view of gene At4g38180
Predicted Position of Insertion Chr4:17908525 - go to primer design
BLAST e Value 2e-17
Hit Clone Code (BAC ID) F20D10
Hit Gene Code At4g38180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FAR1-related sequence 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL760497 [GenBank] CR396353 [GenBank] CR396354 [GenBank]


Last Updated on 31.08.2016 09:40