SimpleSearch - Line and FST details


Line specific information

 
Line ID 202B02
Vector Used pAC161
Line Availability only available from NASC (N419310)
Segregation Analysis 50:31:25
Confirmed for Hit F20C19
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F20C19

 
Sequence (A. th genome BLAST matches underlined)
>10-K014489-022-202-B02-8409
CTGATAATAGTCCAACGCCCAGAATCTTTTTGCTGTACATGTTACTCTAATGGGCTATTG
CCTGGGCTCCAATTTTCTTGCTGCACAATCGTTGTAGGCTTTAAGTCTTGTATCTTTTGT
TTAATAAAATTCACTTGGGAAAAAAAAAAAACCGCCTTCCTTCTCACGGGGGGGAGGGGC
TTTTT
GenBank Accession AL760746 [GenBank]
Graphic View Graphic view of sequence AL760746 of line 202B02
Predicted Position of Insertion Chr3:9666153 - go to primer design
BLAST e Value 8e-55
Hit Clone Code (BAC ID) F20C19
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23