SimpleSearch - Line and FST details


Line specific information

 
Line ID 202G01
Vector Used pAC161
Line Availability only available from NASC (N419369)
Segregation Analysis 100:93:66
Confirmed for Hit T14N5
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T14N5

 
Sequence (A. th genome BLAST matches underlined)
>07-K014485-022-202-G01-8409
CTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTACATATTTCATTGANTCAAATAC
CCTTAATGATAAAACACGTGTATTATTTAATGGATCATTAATTCAAACTTAAGACGAAAT
GACCATGGACAGCTAGGGGAGGGATCCTACCTAGAGTGAGANNNNNNACTNNNNCATANN
NNNTANNGNCNTNNNACTNNGNNATAAGGNTATGANAACCTAATTTAANTANTANNTCTG
TGTATCTTCTTCTTGAAAATGTTTCTATGGGATCCTCCCATACGTGAG
GenBank Accession CT026180 [GenBank]
Graphic View Graphic view of sequence CT026180 of line 202G01
Predicted Position of Insertion Chr1:29036964 - go to primer design
BLAST e Value 6e-34
Hit Clone Code (BAC ID) T14N5
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23