SimpleSearch - Line and FST details


Line specific information

 
Line ID 202G01
Vector Used pAC161
Line Availability only available from NASC (N419369)
Segregation Analysis 100:93:66
Confirmed for Hit T14N5
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T14N5

 
Sequence (A. th genome BLAST matches underlined)
>58-K020163-022-202-G01t-8409
TAATTCAAACTTAAGACGAAGGCGACCACGGACACTATGTGAGTGGTTCCTATCTTGAGA
GAGTGGATTCTTCCCTTTGTGGGGCCTATGTGATTTTCCCTCTCTATAGGATGCTTCCTT
TCGTGAGAGAGAGCTGCTTTCCTTTTTATAGAAGATATTGTTTTTCCCCTTTTTATTAAG
ATCCTATGGGATCCTCCCTATT
GenBank Accession FR805681 [GenBank]
Graphic View Graphic view of sequence FR805681 of line 202G01
Predicted Position of Insertion Chr1:29036976 - go to primer design
BLAST e Value 0.12
Hit Clone Code (BAC ID) T14N5
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR805681 [GenBank]


Last Updated on 31.08.2016 09:40