SimpleSearch - Line and FST details


Line specific information

 
Line ID 203E06
Vector Used pAC161
Line Availability only available from NASC (N419446)
Segregation Analysis 100:78:60
Confirmed for Hit At5g64800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g64800

 
Sequence (A. th genome BLAST matches underlined)
>45-K014507-022-203-E06-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACTTTTACTAAAATTCCCTCAAC
TCTTACGATAAGAGCAGAGAGAAGAAGAAGAAGAAGAAAGTAATCGTGATTTGAGAGAGA
GATTCAAACATACTTTTTTCGATATCTATGTTAATTTTATCTTCACGATATGCAATGAAA
CGAGATGTTTTAATCATTGTAATCTTTACAGTGTTAGTATTAATCATTATCTCCCGTTCA
AGTTCGATCCAAGCTGGAAGATTCATGACTACAGGAAGAAATCGTAATTTGAGCGTTGCT
CGATCACTATACTACAAGAATCATCACAAGGTTGTGATCACGGAGATGTCAAATTTTAAT
AAAGTTAGACGAAGATCGCCTATGGGATCCTC
GenBank Accession AL760873 [GenBank]
Graphic View Graphic view of gene At5g64800
Predicted Position of Insertion Chr5:25905994 - go to primer design
BLAST e Value 1e-142
Hit Clone Code (BAC ID) MVP7
Hit Gene Code At5g64800 [TAIR] [MIPS] [SIGnAL]
Gene Annotation CLAVATA3/ESR-RELATED 21
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23