SimpleSearch - Line and FST details


Line specific information

 
Line ID 203G10
Vector Used pAC161
Line Availability only available from NASC (N419474)
Segregation Analysis 100:67:63
Confirmed for Hit T5P19 At3g56400
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F2A19

 
Sequence (A. th genome BLAST matches underlined)
>79-K014506-022-203-G10-8409
TTGATCCATGTAGATTNTCCCGGACCATGAAGCACTATACTCAGTGGACCTGTCCTTTAC
CTAATACACTCACTCTACAAATTCAAAATTAAAAATCAACGCAAATTATCTCAAGTGTAT
TATTTTTAGTTTTTCGTCATGTGCACTAACTACATTTAACGTGTAAAGCTATATACTGAT
CTCAGCTCCATATGCATTACTTTCTTTCTTCTTTCGATCATATGCCCTTACCCTTTATGG
TTTATATAGCTATGGGATCCTCCCTTAGGTGAG
GenBank Accession AL760906 [GenBank]
Graphic View Graphic view of sequence AL760906 of line 203G10
Predicted Position of Insertion Chr3:22791252 - go to primer design
BLAST e Value 4e-112
Hit Clone Code (BAC ID) F2A19
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit T5P19

 
Sequence (A. th genome BLAST matches underlined)
>34-K105033-0022-203-G10C-3144
CCTTGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCC
GGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTGGATATCAAAAT
TATCTTCATAGAAAAACGGATCATATCATTTGGATATCAAATTTAACTCGAGATTTCAAA
TAAATAATTCACTATTCCAACTGATCTTACTACATCAGTAAAAAAAAATTGGTAGTACAA
TCTCGAGGAACAAAAAAGTTTACAAATGAAATTTAGAATCTTGTTTAATCTTTAAATGGA
TAGTTTTTCATAACTCTTTTAATTAGTCTAGTTTTTGATACAAATTTTATCCGGTTATAG
AAAACATTAAAGGACCCTAAGTTTGGATTTCAGCAAAATTATATATATTCCATTCTCACT
TAGGGATGAAATGACATCATTCATCACTACGTCATTTGAGCTTACGTCAAGCTCACCATA
AGCAAAAGAAATGGGTGGATAAGTTCAAGTTCCATCTCATTTCCTCACACATCTCTCTTT
CTTCCTTCTCATTTCCTCGCATCTTCCTCTAAAAAAAAAAATCAAAGAAACCAACAAAAT
AAAAAGTGCCCATCATTACAAATCTTATTTCCACCTTATATTTACACACACTTCTCTTCT
TTCCTTTAATCATACAAACCACCCCAAGAGGAAAGAAAAATAAGATACCACTCACCAAAA
ACTTCCTCAAAACTAACAAATGGATACTAATAAAGCAAAAAAGCTTAAAGTTATGAACCA
ACTCGTTGAAGGCCATGACTTAACAACTCAGCTTCAGCAACTCCTCTCTCAACCCGGGTC
CGGTCTAGAGGATCTAGTGG
GenBank Accession LN713401 [GenBank]
Graphic View Graphic view of sequence LN713401 of line 203G10
Predicted Position of Insertion Chr3:20911035 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T5P19
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g56400

 
Sequence (A. th genome BLAST matches underlined)
>79-K014507-022-203-G10-8409
TGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGTTCACTTCGGACCTTGG
GAATTTGGCATTAAGAATCTCCTTTTGTCCATATTTCCTCCAAGAAAATGCGTCCTCAAG
TATAGTCGACTCTATAGTACACGTCTCCGATCTCTTTCTGCTCATAATATTAATGAAATC
AATTAATCATTTGGCTACTTATGATTCTTGCAACCAAAGCTAAATGTCTTGTTTGTTTGT
GACTAACCATAACAGTAAGTAAATCCTATGGGATCCTCCCTTAGGTGAG
GenBank Accession BX572218 [GenBank]
Graphic View Graphic view of gene At3g56400
Predicted Position of Insertion Chr3:20909730 - go to primer design
BLAST e Value 3e-119
Hit Clone Code (BAC ID) T5P19
Hit Gene Code At3g56400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 70
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40