SimpleSearch - Line and FST details


Line specific information

 
Line ID 207D11
Vector Used pAC161
Line Availability only available from NASC (N419823)
Segregation Analysis 100:80:51
Confirmed for Hit At1g60220
Parent of DUPLO pair 2303
Parent of pair(s) none

Gene hit At1g60220

 
Sequence (A. th genome BLAST matches underlined)
>84-K014550-022-207-D11-8409
TTGATCCATGTAGATATCCCNGCACATGAAGTCCTCTATATTGCAAATTTACATGAAGTC
AGGCTATGGAATCGCTGCCCTATAGATGAGATTGTGGCAAACCTCCCTGTAACTGTTTTT
TTTACTATCTCCTACGGCAGCAGGGCTTGGAAAAACTGGCGATACTGACTTCGGACTCCC
CCTAAAACGGTGGGATTGCCGGATTACGGAGCAACTTTCGCTAGAGATGCCTGGGCTCGC
GCGTGACCGAGTTGGTATCCTCCCTATTCAGTGTGTCCTCTGATTCCTATAGTTTTTTTA
GGGAATATCATCAATAAGTAAGAAAAACAACATAACAAATGAGTTGGAGTAAAGACAATA
TTAAAGAAGCCAAATAAATGATCTAGTCAAGTGGGAAGTTTTCCTGGCAAGCTATAAATC
CTGCAGTTCATCTATGGGATCCTCC
GenBank Accession BX942886 [GenBank]
Graphic View Graphic view of gene At1g60220
Predicted Position of Insertion Chr1:22210443 - go to primer design
BLAST e Value 1e-62
Hit Clone Code (BAC ID) T13D8
Hit Gene Code At1g60220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UB-like protease 1D
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g12880

 
Sequence (A. th genome BLAST matches underlined)
>84-K014553-022-207-D11-8409
TGATCCATGTAGATTTCCCGGCCGTTTAGTCCTTCTATTTGCAAATTTATCTTTTTGTCA
GCCTATAGTATCCTCCCTTTTTGCTATGGAATCTAACAACACGGCAACTTTTTTTTTTAA
TTATCTCCTTTGGGATCCTCCCTTTAGT
GenBank Accession AL761312 [GenBank]
Graphic View Graphic view of gene At5g12880
Predicted Position of Insertion Chr5:4069068 - go to primer design
BLAST e Value 4e-04
Hit Clone Code (BAC ID) T24H18
Hit Gene Code At5g12880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation proline-rich family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03