SimpleSearch - Line and FST details


Line specific information

 
Line ID 207G10
Vector Used pAC161
Line Availability only available from NASC (N419858)
Segregation Analysis 100:98:78
Confirmed for Hit At3g53130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g53130

 
Sequence (A. th genome BLAST matches underlined)
>79-K014550-022-207-G10-8409
NTGATCCATGTAGATTNTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGGAAAC
CAATTGTATATGAAGGTGAGCCAAAGGTAAAAACCAGAATTTATGTTTTCATGATAATTG
ATTGGTGTGAATGGACTTGTTTCATAGTACTCTTGAGAAATAACCACAAAAAAATGAATT
ATGGAAAATAGTTGTACCATCGGAAATGTGAATTTTGAACAGTGAGATGCTATGGGATCC
TCCCTTAGGTGAG
GenBank Accession BX890881 [GenBank]
Graphic View Graphic view of gene At3g53130
Predicted Position of Insertion Chr3:19695247 - go to primer design
BLAST e Value 1e-78
Hit Clone Code (BAC ID) T4D2
Hit Gene Code At3g53130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cytochrome P450 superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03