SimpleSearch - Line and FST details


Line specific information

 
Line ID 208B08
Vector Used pAC161
Line Availability only available from NASC (N419892)
Segregation Analysis 50:32:28
Confirmed for Hit At5g03720
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g03720

 
Sequence (A. th genome BLAST matches underlined)
>58-K014551-022-208-B08-8409
TTGATCCATGGTACNGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGCTC
TGTTTCTGTTACAATTGGTAAATACTGACGAAGCTTAACACTTATGTAATCATCTCTCTT
GCTCTGTTTCTGTTTTCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL766152 [GenBank]
Graphic View Graphic view of gene At5g03720
Predicted Position of Insertion Chr5:973388 - go to primer design
BLAST e Value 2e-18
Hit Clone Code (BAC ID) F17C15
Hit Gene Code At5g03720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heat shock transcription factor A3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g05670

 
Sequence (A. th genome BLAST matches underlined)
>58-K014554-022-208-B08-8409
NTTTGGATCCATGTAGACTTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGCT
CTGCATGAGTAACAATGGGATGATTGTGACGAAGCTTAACAACTTATGTGACTCTGCTGT
CTTGCTGCTGCGTCTGGTTCCTAAGGGAACCTCCATATAGTGAGACCTGGATATTTTTAT
TTAATGATGAATCAGTGGGAAATAAAACGATTATGAAGTTACTATTTTTAGCAGATGTTG
ATTTGAATGTTTCAGATGAAAATGTAACGGCCATAAATATTTATTAAAAAAACTAATAAA
GAAGACCAAAAGAATTACATACTACAAAACCAGGTAAAATTTTCTGGGTTACCTTTTCAC
ATTTTCAGTTATCTTAATGCATTTCCTATGGGATCCTC
GenBank Accession AL766153 [GenBank]
Graphic View Graphic view of gene At3g05670
Predicted Position of Insertion Chr3:1653142 - go to primer design
BLAST e Value 6e-108
Hit Clone Code (BAC ID) F18C1
Hit Gene Code At3g05670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 07.07.2016 14:03