SimpleSearch - Line and FST details


Line specific information

 
Line ID 208G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N419956)
Segregation Analysis 50:48:37
Confirmed for Hit At5g38100
Parent of DUPLO pair none
Parent of pair(s) 4469, 10009, 10025, 11249, 96562

Gene hit At5g38100

 
Sequence (A. th genome BLAST matches underlined) 
>95-K014551-022-208-G12-8409
TTTTNCTCAATCTCTCCCTTTATTCACTAAATTGAGGAAAATATACCTGCAACTAAATAA
AAGATCTTTTCCTCGCCTTGTATTCCCTAAAAAAAGATAACTAGTGATACCTAAAACCAA
TATGCTTTTTAGATATCCTAAAAGAAAAATTAT
GenBank Accession FR805779 [GenBank]
Graphic View Graphic view of gene At5g38100
Predicted Position of Insertion Chr5:15199793 - go to primer design
BLAST e Value 1e-13
Hit Clone Code (BAC ID) F16F17
Hit Gene Code At5g38100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit FR805779 [GenBank]


Last Updated on 10.06.2021 13:37