SimpleSearch - Line and FST details


Line specific information

 
Line ID 208H06
Vector Used pAC161
Line Availability only available from NASC (N419962)
Segregation Analysis 100:93:86
Confirmed for Hit At2g16280
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g16280

 
Sequence (A. th genome BLAST matches underlined)
>48-K014551-022-208-H06-8409
CTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACTATCGAACAGAGGCACATCTG
GTCTTTTCTTGATCTTCTCTCCTTGTGACTAAAAACAGCAAGGAAACAAACAGGATCTCC
TGGAAACGAAATGACGGATCCATTAGCGGAGGCAGCTCTATACGATGCTATTCCTATAAT
ACGGCATTACTCATTTCCTTGATATATGCACAAATTCTCATAAAGTTTTCAATTTTATTC
CATTTTTCTCGGAAGCCATGGAAGCTGCTAATGAGCCTGTTAATGGCGGATCCGTACAGA
TCCGAACAGAGAACAACGAAAGACGAAAGCTTCCTAATTTCTTACAAAGCGTCAACATGA
AATACGTCAAGCTATGGGATCCTC
GenBank Accession BX572222 [GenBank]
Graphic View Graphic view of gene At2g16280
Predicted Position of Insertion Chr2:7050987 - go to primer design
BLAST e Value 2e-92
Hit Clone Code (BAC ID) F16F14
Hit Gene Code At2g16280 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 3-ketoacyl-CoA synthase 9
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g73230

 
Sequence (A. th genome BLAST matches underlined)
>48-K014554-022-208-H06-8409
CTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAAGTGAAGCCATTTAC
ACGAGATTTTTCATTGATTACTGTTTTTGATATTGGTTATCTTGTTTTCCATAACTTGTT
AGTTAGTTAAAAGTAATGTTTGTGTAATGGTGACCTAATCGATTGAAAAAATTGAAACTT
TAGGTTAAGCTCATTGTAACAATACGAGCTTTGTTCTTCTCGCTGCACTGTTCTCATAAT
CCTATGGGATCCTCCCTTAAGTGA
GenBank Accession AL766256 [GenBank]
Graphic View Graphic view of gene At1g73230
Predicted Position of Insertion Chr1:27541704 - go to primer design
BLAST e Value 8e-92
Hit Clone Code (BAC ID) T18K17
Hit Gene Code At1g73230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nascent polypeptide-associated complex NAC
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 31.08.2016 09:40