Line specific information

Line ID 210F11
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis unknown

Genome hit F21A14

Sequence (A. th genome BLAST matches underlined)
>86-K014135-022-210-F11-8409
TTCACCCACCAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTA
CCCTACTGATGCCCGCGTCGCGATAGTAATTCAACCTA
GenBank Accession AL766433 [GenBank]
Graphic View Graphic view of sequence AL766433 of line 210F11
T-DNA Border not detected
BLAST e Value 3e-49
Hit Clone Code (BAC ID) F21A14
Hit Gene Code  
Gene Annotation  
Insertion Classification  
Confirmation Status unknown

Genome hit MCO15

Sequence (A. th genome BLAST matches underlined)
>86-K014131-022-210-F11-8409
TAAGGAGTAAAAAATGACACAGAGTCTGTCTGTGAACAGTGTCATGTTTGTAAATAAAGA
AGGAAA
GenBank Accession AL766432 [GenBank]
Graphic View Graphic view of sequence AL766432 of line 210F11
T-DNA Border not detected
BLAST e Value 7e-21
Hit Clone Code (BAC ID) MCO15
Hit Gene Code  
Gene Annotation  
Insertion Classification  
Confirmation Status unknown