SimpleSearch - Line and FST details


Line specific information

 
Line ID 210G07
Vector Used pAC161
Line Availability only available from NASC (N420143)
Segregation Analysis 100:95:79
Confirmed for Hit At2g28850
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g28850

 
Sequence (A. th genome BLAST matches underlined)
>55-K014135-022-210-G07-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGACACTCATACTCATTGTT
GGTAAAGCCATTTTTGTCTTCAGATTTGAATCTGGTTCTCTTGGAATTATCAAGACAGAC
TATGGCATGACTTAGCTACCTATGGGATCCTCCCTATAGTGAGAGCTCGCACCAATGCGT
GGGCCAACGTTACGCGCTGAACCACCTCGTGCTCTTCATTGCCATGTTCTCCTCGATGTT
TGATTTCAAGAGGGCCCGATCACATGGTTGCGATGAGATTGTGCATATCCCCACGATGTC
GCCAAAGGACGGGTGCACGGAGTTCTTGCCTATGGGATCCTCCCTATAGTGAGTTACCAC
TTCTGGCTCCCGACTCCC
GenBank Accession BX649778 [GenBank]
Graphic View Graphic view of gene At2g28850
Predicted Position of Insertion Chr2:12383776 - go to primer design
BLAST e Value 2e-80
Hit Clone Code (BAC ID) F8N16
Hit Gene Code At2g28850 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 710, subfamily A, polypeptide 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23