SimpleSearch - Line and FST details


Line specific information

 
Line ID 211B01
Vector Used pAC161
Line Availability only available from NASC (N420173)
Segregation Analysis 50:44:32
Confirmed for Hit At4g38900
Parent of DUPLO pair 2330
Parent of pair(s) none

Gene hit At4g38900

 
Sequence (A. th genome BLAST matches underlined)
>02-K014136-022-211-B01-8409
ATTGATCCATGTAGATTNTCCCGACATGAANGCCTTTACAATTGAATATATGCTGGAACT
TGAAGATTCGATCCTATGGGATCCTCCCTATAGTGAGGTGACATTGACCGTGAATGATTA
GCTCCTCCCGGGTTAAAATTATGCGAACCGGGTTGTCGGGTGGTCGGGATCTGAGAAAAC
GGAGAACTCGGTGGGATTAAGTTGGGGTGCGACGGAGGAACACCGATTCGTTTGCCACTG
TCACTGAAAGGCTTGGAGAATTGAGGAGCTGATGAGCGGATGACATTAGGGTTTAAATTG
AGCTGAGAAATGGGATTTTTGGGAATGGAAGAAGAAGTAGTGCCGAAAGATGAATGAAGT
CTCTGGATCATATCACTGTTACACTTCTCTGGCCTACCCATATTAGATC
GenBank Accession AL766475 [GenBank]
Graphic View Graphic view of gene At4g38900
Predicted Position of Insertion Chr4:18141178 - go to primer design
BLAST e Value 4e-158
Hit Clone Code (BAC ID) T9A14
Hit Gene Code At4g38900 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Basic-leucine zipper (bZIP) transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL766474 [GenBank]


Last Updated on 07.07.2016 14:03