SimpleSearch - Line and FST details


Line specific information

 
Line ID 211D05
Vector Used pAC161
Line Availability only available from NASC (N420201)
Segregation Analysis 100:75:64
Confirmed for Hit At3g18870
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g18870

 
Sequence (A. th genome BLAST matches underlined)
>36-K014132-022-211-D05-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTTCGGCCTGTATCCTCTTCCCAAGCT
AAACGCAAAATACTGCGGAAACTTCTTGAGCTCTTCAAGTTCTCTTTCCATGTCGTAAAC
GAGAAACTCGAACTTGGGCCTCAAGTTATCTTCAACACTGTATCCGAATATCGGCCGGGA
TTCTCCCACAGACTCTATGGGATCCTCCCTTAAGTGAGACAGAAATCTGAAAACAAAAAA
GGTGAATTGCATTTCAAGGAAAAGTGATTTTGAATCATATGAAAATTCTTGAGGGAATCA
TTGAAAATTCAAATCCCGGGTTCGATCACAGACTCTCTTTTAAGGTTACTGACGAATTAC
AAGATCGATATCGGCCCCAACTTCTGCAATCTTGGCTTCCTTTGACGCCTTCGCTGATTT
TGCGATGCTCTCTACATCAAAATCTATCGCTATCTTCTTCACGAGACCTTCAAGCATCTG
TTGTTACAAACACACACCGATTAAATTATGTAATTAACAACAAGTGGATTACGTTACTCT
ATGGGATCCTC
GenBank Accession BX285298 [GenBank]
Graphic View Graphic view of gene At3g18870
Predicted Position of Insertion Chr3:6508639 - go to primer design
BLAST e Value 1e-179
Hit Clone Code (BAC ID) MCB22
Hit Gene Code At3g18870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial transcription termination factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL766513 [GenBank]


Last Updated on 07.07.2016 14:03