SimpleSearch - Line and FST details


Line specific information

 
Line ID 211E03
Vector Used pAC161
Line Availability only available from NASC (N420211)
Segregation Analysis 50:42:31
Confirmed for Hit At2g27880
Parent of DUPLO pair none
Parent of pair(s) 3254, 3336

Gene hit At2g27880

 
Sequence (A. th genome BLAST matches underlined)
>21-K014132-022-211-E03-8409
TTGATCCATGGTAGATTTCCCGGGACATGAAGCCTATTACAATTGAATATATGCTGTGGC
AGCCTTGCATGCTCGGTATGTAATCCTTAAATACACACTCTTATACCTAAAACTACTGAC
TGTCGCGATGCTACCCGACTTAGCAGTAACCCATAACCTTACATATTATATATCAGATGC
TAAGGGACCCATTCTTTTATTGAGTTTCAAGTGCCTACAGAGAGCAAAAAGATTATGATA
GTCAATTACAGTTTTACCTTGTCAATCATGTTCCACTGTCCTATGGGATCCT
GenBank Accession AL766526 [GenBank]
Graphic View Graphic view of gene At2g27880
Predicted Position of Insertion Chr2:11874637 - go to primer design
BLAST e Value 2e-39
Hit Clone Code (BAC ID) F15K20
Hit Gene Code At2g27880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Argonaute family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL766526 [GenBank]


Last Updated on 31.08.2016 09:40