SimpleSearch - Line and FST details


Line specific information

 
Line ID 213B04
Vector Used pAC161
Line Availability only available from NASC (N420368)
Segregation Analysis 100:84:55
Confirmed for Hit At3g27070
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g27070

 
Sequence (A. th genome BLAST matches underlined)
>26-K014134-022-213-B04-8409
TTTGATCCATGTAGATTTCCCTGGAATGAAGCCATTTACACTTGAATATATCAAGCTATA
GCATCCTCCCTATAGTGAGACTATGGGATCCTCCCTATAGCGTCTTCACTGAATGAGATG
GCTTCTATGCGGACATGATTGAATAGACACTAAAGCAGCTTTTCATCACAAATAATTAAC
ATAAGCTTGAAGCATCATCATACCTACAAGAGCTCGAAACATTAATAAAACAAGTTCAGG
CTTTTAAAGAATACATACGTGATATTACAATACTAAAAACATTTGATTCCTATAATGGTT
AGGGAATCCACATTGTGCAATATTCAACTATGTTAAGTTATTAACACATAAAGCAAACAT
TTACCACCAAAAAAAAAAAAAAAACCCCCCTT
GenBank Accession BX942890 [GenBank]
Graphic View Graphic view of gene At3g27070
Predicted Position of Insertion Chr3:9984019 - go to primer design
BLAST e Value 2e-92
Hit Clone Code (BAC ID) MOJ10
Hit Gene Code At3g27070 [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocase outer membrane 20-1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23