SimpleSearch - Line and FST details


Line specific information

 
Line ID 216D08
Vector Used pAC161
Line Availability only available from NASC (N420684)
Segregation Analysis 100:52:52
Confirmed for Hit At4g15880
Parent of DUPLO pair none
Parent of pair(s) 1561, 60898, 93478

Gene hit At4g15880

 
Sequence (A. th genome BLAST matches underlined)
>60-K014145-022-216-D08-8409
GTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGCCATT
CATGGGATACAGAAGCCAGAGACAACTGAGTACCATGGGGAGAAACAAGGCCAAATATAT
CAATAATCTTATCATAAAGATCACTTAAACATACTGCTTATCATTTTTATGGAAGCAAGT
AGCAGCTACTCAGTCGAACTGACATGAGGCAAAAAGGATCAAATTTTTGTTAAAAATCAT
CTGAGCAGAAAGAAAACAAACCTTTTTGTAGAAAAAGGTGTTGAAGTAGTGACACTTCAA
ATACTTTTTGGGCTCACTATGGGATCCT
GenBank Accession BX572226 [GenBank]
Graphic View Graphic view of gene At4g15880
Predicted Position of Insertion Chr4:9014462 - go to primer design
BLAST e Value 2e-144
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g15880 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cysteine proteinases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR805911 [GenBank]


Last Updated on 14.10.2014 10:23