SimpleSearch - Line and FST details


Line specific information

 
Line ID 217A09
Vector Used pAC161
Line Availability only available from NASC (N420745)
Segregation Analysis 50:45:41
Confirmed for Hit At5g60410
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g60410

 
Sequence (A. th genome BLAST matches underlined)
>65-K014146-022-217-A09-8409
NTGATCCATGTAGAATATCCCGGACATGAANGCCTTTACTCTCATGCCTACTATAGAATC
TTCTCTTTTTCAGGGGCCATTATTGTGTGAATTGGTACTTTATAAGTCACTTTGACTTTA
AATTTTCTACTTGGAACTGGTATAAGACATTCATCCTATGGGACCCTCCCTATAGGGAGC
ACCGGCTGGGATGAAGCCTGTAAAGTGTCTTTCG
GenBank Accession AL767169 [GenBank]
Graphic View Graphic view of gene At5g60410
Predicted Position of Insertion Chr5:24297009 - go to primer design
BLAST e Value 6e-37
Hit Clone Code (BAC ID) MUF9
Hit Gene Code At5g60410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA-binding protein with MIZ/SP-RING zinc finger, PHD-finger and SAP domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40