SimpleSearch - Line and FST details


Line specific information

 
Line ID 217H12
Vector Used pAC161
Line Availability only available from NASC (N420832)
Segregation Analysis 100:70:69
Confirmed for Hit At1g13260
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g18470 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g18470

 
Sequence (A. th genome BLAST matches underlined)
>90-K020163-022-217-H12t-8409
GCTTGAGGAAATCCAGGTGCTGCTATTGTTACTGCTGAGAGAAAAGGTTACAGTGATTTG
GCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX530837 [GenBank]
Graphic View Graphic view of gene At5g18470
Predicted Position of Insertion Chr5:6128994 - go to primer design
BLAST e Value 6e-25
Hit Clone Code (BAC ID) F20L16
Hit Gene Code At5g18470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Curculin-like (mannose-binding) lectin family protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 495G08

Gene hit MTH12

 
Sequence (A. th genome BLAST matches underlined)
>96-K014142-022-217-H12-8409
TTGATCCATTGTAGATTTCCCGGACATGAAGCCGTTCTAAACCCCGTCGTAGAAACACCA
TCATTATCTCAACCCCGACGTTAACAACGTCCTAGTTCTTGACGCCCTTCGAAAACTATA
CATAGACTAAGATAGCTGAGGTATATGACTTTGTTCAACCCTTCTTTCTCCTTTGGGGCA
AAAGGCTCGTCCGAGTACGCAAAATGAATCTTGATCTCCATATACAAACTTTGTATGTAG
TGTTACTATCTGTACCTAAGAAAATATAAAGCGGACGGGATTTCAAACGGAACAGAACTT
TATAAGATCATTTACTTGAGGATATTTGGATCAAAATAGAGTATATGAAAATACAGAAAC
TTCCAACTGACTTACACAAAAATATATACCAATATTTAACAATAAATAGACCAAAATGGC
ATTATTATCCAATTCGTTTTGAAAAATTGAGCGTTATTCTATTGAATACCTAAAGTATAG
TCTATGGGATCCTCC
GenBank Accession AL767279 [GenBank]
Graphic View Graphic view of sequence AL767279 of line 217H12
Predicted Position of Insertion Chr5:24090050 - go to primer design
BLAST e Value 8e-132
Hit Clone Code (BAC ID) MTH12
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g13260

 
Sequence (A. th genome BLAST matches underlined)
>96-K014146-022-217-H12-8409
ATTGATCCATGTAGATTTCCCGTACATGAAGCCGATCTAAACCCCGTCGTAGAAACACCA
TATTACTCAACCCCGACGTTACAACGTCCTATAGAATCCTCCCTATAGTGAGACTATGGG
ATCCTCCCTATAGTGAGGCTATGGGATCCTCCCTATAGTGAGCTACACTGAATTGGTAGC
TCCCATTTGGACGTGAATGTAGA
GenBank Accession AL767280 [GenBank]
Graphic View Graphic view of gene At1g13260
Predicted Position of Insertion Chr1:4542936 - go to primer design
BLAST e Value 8e-18
Hit Clone Code (BAC ID) T6J4
Hit Gene Code At1g13260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation related to ABI3/VP1 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03