SimpleSearch - Line and FST details


Line specific information

 
Line ID 219G07
Vector Used pAC161
Line Availability only available from NASC (N421007)
Segregation Analysis 50:44:28
Confirmed for Hit At4g08320
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g08320

 
Sequence (A. th genome BLAST matches underlined)
>55-K014202-022-219-G07-8409
TTTGATCCATTGTAGATTTCCCTGACATGAANGCCTTTACAATTGAAGCCATTTACAAAA
CTTATAACCAAACTCATAACCAACAGAAGAAGTAAAACCGTCAAAGAAAATCAAACCTAC
ATTGACACAATCATGAAATATCCTTGTAGCTTTCTCCAGCTGAGCAGGATCATCATCTCC
ATCAGGTGTATTCCTAAAATACCGTACTTTCTCAAGCGCACCAAAGAGTTGACCAAACAG
TTCATCCCTATGGGATCCTCCCTTAGGTGAG
GenBank Accession AL767501 [GenBank]
Graphic View Graphic view of gene At4g08320
Predicted Position of Insertion Chr4:5253590 - go to primer design
BLAST e Value 2e-104
Hit Clone Code (BAC ID) T28D5
Hit Gene Code At4g08320 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23