SimpleSearch - Line and FST details


Line specific information

 
Line ID 220B01
Vector Used pAC161
Line Availability only available from NASC (N421037)
Segregation Analysis 50:50:32
Confirmed for Hit At2g40950
Parent of DUPLO pair none
Parent of pair(s) 11691

Gene hit F3D13

 
Sequence (A. th genome BLAST matches underlined)
>02-K014203-022-220-B01-8409
GTTTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTAGACGTAGAAGAAAG
TTTTTACGTACCAAGAAAATTTAAATCGCAACGAAGAATAATATTTTCTAATGCAAGCAT
GATATAGTAATACTCTAATAGCATAAGAACAGGGTAAACCTATGGGATCCTCCCTATAGT
GAGACTATAGAGA
GenBank Accession AL767536 [GenBank]
Graphic View Graphic view of sequence AL767536 of line 220B01
Predicted Position of Insertion Chr4:590883 - go to primer design
BLAST e Value 3e-51
Hit Clone Code (BAC ID) F3D13
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g40950

 
Sequence (A. th genome BLAST matches underlined)
>02-K014205-022-220-B01-8409
TTGATCCATGTAGATTNTCCCGGACATGAAGCACTTTACAATTGAATATATAATTAGATC
TATAGTTCCCATAAAAAGCACCACTTAATTCCTCCATAATTAACGTTCACAGATTGGAGC
TAATGCACCAAACAAAAATAGACAAAACAGAGAGACCCAGAAAAC
GenBank Accession AL767537 [GenBank]
Graphic View Graphic view of gene At2g40950
Predicted Position of Insertion Chr2:17089107 - go to primer design
BLAST e Value 8e-46
Hit Clone Code (BAC ID) T20B5
Hit Gene Code At2g40950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Basic-leucine zipper (bZIP) transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03