SimpleSearch - Line and FST details


Line specific information

 
Line ID 220D04
Vector Used pAC161
Line Availability only available from NASC (N421064)
Segregation Analysis 50:11:4
Confirmed for Hit At2g37710
Parent of DUPLO pair none
Parent of pair(s) 6269, 6276, 6279, 6288, 6357, 8847, 8865, 87746, 87765, 87785, 87801, 87862, 87879, 87880, 87881, 87882, 87883, 87888, 87889, 87890, 87891, 87892

Gene hit At2g37710

 
Sequence (A. th genome BLAST matches underlined)
>28-K014205-022-220-D04-8409
TTGGATCCATGTAGATCTTCCCTGACATGAAGCATTTACAATTGAATATCCGAATACTCT
TGGCTGCTAAAGATCCGAATATGGGTTCGGAATGTGATGAAAAAGAGGTGGAAATGGTTT
TGAAGCTATGGGATCCTCCCTATAGTGAGAC
GenBank Accession AL767576 [GenBank]
Graphic View Graphic view of gene At2g37710
Predicted Position of Insertion Chr2:15815244 - go to primer design
BLAST e Value 4e-32
Hit Clone Code (BAC ID) F13M22
Hit Gene Code At2g37710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation receptor lectin kinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g55260

 
Sequence (A. th genome BLAST matches underlined)
>28-K014203-022-220-D04-8409
CTGATCCATGTACATTTCCCGGACTGAACGTCCTATTATATCTTTTGCCAACTGGTTTTT
ACCGGTTATATAGTCTGATAATGATTGAAGAAATAGTGTCGATTTCTAAAAGTAGACAAT
CCACAGGACATGCGTGTGGGTCAATATATATTTGAAAAGATCAAGGGTATAATCTCTAAA
TCTGTTGAGGATATGTATATGTAAATAATTTTTTAAAACCACTAAATCAAATGTCTCATA
TATACCACATTTGGATATTACAAGCAATCAAGCATTAACTCCATAATTTGTTGAATAATG
ATCCTGAACAATTGGATAGAGATATTTATATAAACATATTGATAGAGATTGAAGGTGGTG
TCACGTCGCAACATTTATATTATCAATTAATTCAATAATCTCACCATATTGTTTTGGTGT
TATTTTAATCATATTATTCCATTTTTTGAACCATACGTCTGCATATACAATCATAATTTT
TACATGTAGGCTAAATGATAAGCCCAAAATTTATGAGAGCAATTAATGATCGTCGAGCCC
TATGGGATCCTC
GenBank Accession AL767575 [GenBank]
Graphic View Graphic view of gene At1g55260
Predicted Position of Insertion Chr1:20614386 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F7A10
Hit Gene Code At1g55260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 07.07.2016 14:03