SimpleSearch - Line and FST details


Line specific information

 
Line ID 220E03
Vector Used pAC161
Line Availability only available from NASC (N421075)
Segregation Analysis 50:7:7
Confirmed for Hit At1g27780
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At4g05280 can not be ordered because the confirmation of this insertion failed.

Gene hit At4g05280

 
Sequence (A. th genome BLAST matches underlined)
>21-K014203-022-220-E03-8409
NTTGGATCCATGTAGATTTGCCTGACATGAATGCCTTTACAATTGACACTCATACCCTAT
GGGATCCTCCCTATAGTGAGCATCACAAATAAGTATGTTAACCATAGATAATGTACATTT
ACTTATTATGTACGTACATACACAATTTAACACACCTCATCAGCAGCCTCACACTCCAAA
ATGCGAGATGTCCGGATTGCTCGCAGAGAGGCAAGACGATGGATAGACCTCTCAGCAAAT
GTCCTGTTAGGTACATCATCAGGTCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL767590 [GenBank]
Graphic View Graphic view of gene At4g05280
Predicted Position of Insertion Chr4:2698940 - go to primer design
BLAST e Value 3e-100
Hit Clone Code (BAC ID) C17L7
Hit Gene Code At4g05280 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status failed

Gene hit At1g20580

 
Sequence (A. th genome BLAST matches underlined)
>21-K014205-022-220-E03-8409
GTCTATCTTTTTCTTTTACTGGTGATACTCCCTATGGAGAGACGAGCTTACCTGTTTTGA
AGCTATGGTGACTGATTGCATGGGCTTTATATATGCCCATATTCATATTAATGCCCAATG
CGAGAAACTAGCTTTTTAGTCCCTATACTTGGACATTATTTTAATGCTTATTCTACGACA
GACGACGGGAGACCTCACGGGTTAAAACGAAGGAACCACCGGTACCAAAACTCGCCGGAA
GAGATGGCGGACGAGATGGAGACCAAAGGAGAGAAGAAGTACAAGTATAGCATAATCATT
CCTACCTACAACGAGCGCCTCAACATCGCTATCATAGTCTACCTGATCTTCAAGCATCTC
CGGTAAATGAATATTTATTTCTTTTGGTCTTTTCACGTTCATTCTTTCATTTCAGAATCC
GAATTACGTTTCTTGTTATTCTTCTACTGAATACTCGAACCTGATCGACAATTTCAAGTT
ACGGATCTCGGAAATTTCCCGATCATGTTTCT
GenBank Accession AL767591 [GenBank]
Graphic View Graphic view of gene At1g20580
Predicted Position of Insertion Chr1:7128896 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F5M15
Hit Gene Code At1g20580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Small nuclear ribonucleoprotein family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At1g27780

 
Sequence (A. th genome BLAST matches underlined)
>21-K014203-022-220-E03-8409
NTTGGATCCATGTAGATTTGCCTGACATGAATGCCTTTACAATTGACACTCATACCCTAT
GGGATCCTCCCTATAGTGAGCATCACAAATAAGTATGTTAACCATAGATAATGTACATTT
ACTTATTATGTACGTACATACACAATTTAACACACCTCATCAGCAGCCTCACACTCCAAA
ATGCGAGATGTCCGGATTGCTCGCAGAGAGGCAAGACGATGGATAGACCTCTCAGCAAAT
GTCCTGTTAGGTACATCATCAGGTCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL767590 [GenBank]
Graphic View Graphic view of gene At1g27780
Predicted Position of Insertion Chr1:9678402 - go to primer design
BLAST e Value 3e-100
Hit Clone Code (BAC ID) T22C5
Hit Gene Code At1g27780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03