SimpleSearch - Line and FST details


Line specific information

 
Line ID 222B10
Vector Used pAC161
Line Availability only available from NASC (N421238)
Segregation Analysis 50:28:21
Confirmed for Hit At3g12110
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F24H14

 
Sequence (A. th genome BLAST matches underlined)
>74-K014236-022-222-B10-8409
GATTTCGGATCATGACAGAGCATCTAACACTTGTAATGGTATGTTATTTGTGACTTCCAC
TAAACAATTAGATGTTTTACTTTTGTATTGATTGATTTGCTACTGGGATCCTCCCTATAG
TGAGAAGCCTCTATGAGAAATGAAGGGTTTTAAAAGAGTTGGTTTTTCTTTCGTGGGCTA
CCCGCATACCCGCAGTCCGCAACGGGCTTGTCCGCAACGGGCTTGTCCGCTATAATCCGG
AGTCCGTAATGGGCCTGCCCGCGAGACCCGCTAATTTGTGGACAAAAAAATCAACGTCCA
ATCCCGTTCCGCCATGGGCTACTTGGACAAAGCCCGCGGGCTATGGGATCCTC
GenBank Accession AL767818 [GenBank]
Graphic View Graphic view of sequence AL767818 of line 222B10
Predicted Position of Insertion Chr2:8035738 - go to primer design
BLAST e Value 3e-103
Hit Clone Code (BAC ID) F24H14
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g12110

 
Sequence (A. th genome BLAST matches underlined)
>74-K014240-022-222-B10-8409
TTGATCCATGTAGATTTCCCGGACATGAACGCCTTAAGGGATTTTGGTCGTGAGATTATA
AAAAGGATCTTCACCTATGGGATCCTCCCTATAGTGAGTCCAATGATCTATAAAATCAAC
CACCCGTACATCACCACGACCCTACTCGTTTCCTATGAAATCCGCTCTATAACTATAACG
GTGATCCCTTATCCATAGCTGTACACACATAGTGGTTCTTCATATAATGAGCCTATATGA
GAGACTACCCAGTCACTACTTCTCTGTGGTACATCATATCATTACTGAGTGGCTCGCCTA
TGAATGGTTCGTGTACGCTGATGTTTTGTATATACATTCGAGACAGGGTATACATTATGA
CATATGGAGATGACATGCAGACTCTCGTATGTGACGCTGGTACCGGAATGGTAGAGGCAC
ATCTTCCCATGACCTTCGCGGATTAAAATGTGATAACTTTTTCTTTTATTATTTTTGGAT
ACAATGCTGTTTTGTCTGGTTCATTCATATGTGTTTCCAATTCCTTAGGCTGGATTTGCT
GGAGATGATGCACCAAGAGCTGTATTCCCTATGGGATCCTCC
GenBank Accession AL767819 [GenBank]
Graphic View Graphic view of gene At3g12110
Predicted Position of Insertion Chr3:3858131 - go to primer design
BLAST e Value 5e-71
Hit Clone Code (BAC ID) T21B14
Hit Gene Code At3g12110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation actin-11
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03