SimpleSearch - Line and FST details


Line specific information

 
Line ID 223C10
Vector Used pAC161
Line Availability only available from NASC (N421346)
Segregation Analysis 100:82:64
Confirmed for Hit At5g11060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g27180

 
Sequence (A. th genome BLAST matches underlined)
>75-K014237-022-223-C10-8409
TATATACACTCTATCTGAAAATATAACCTTATGCTGTCAAATTACTACTGTGCAAAACTA
ATATCCAAATTTTCTAACTGACGATATATCCATACCCACTGATCATGTCTGTCAGTGCAA
AGTACAACGTCTATGGGATCCTACCTATAGTGAGATTCTGATTCTCATGTATTATAGCAT
TTATTTAAGTTTGAAAATTTTGCTAATTTTAAATTTTAAAAATCTATATCTAAAGAAAAC
AATAGTAAGAGTTCCATATATCTTGAAATTCAGATGCGACTAAATAAATCTTGAATTTCA
GATGTGAATATTACTGAACTTAACTAACTCATACACAACTTGTGTAGGCGACAACTACAT
TACTATATATCGATCGGTTTTGGATGAAGTATTTTAACGATTTTTATATCATTAAATTAT
ATGGAAATAAACTATAGCTATGGGATCCT
GenBank Accession AL767950 [GenBank]
Graphic View Graphic view of gene At4g27180
Predicted Position of Insertion Chr4:13619337 - go to primer design
BLAST e Value 7e-160
Hit Clone Code (BAC ID) T24A18
Hit Gene Code At4g27180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation kinesin 2
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At5g11060

 
Sequence (A. th genome BLAST matches underlined)
>75-K014241-022-223-C10-8409
TCTATCTGAAAATAAACCTTATGCTGTCAAATTACTACTGTGCAAAACTAATATCCAAAT
TTTTAACTGACGATTTATCCAACCCACTGATCATGTCTGTCGGTGCAAAGTACAAGCCTA
TGGGATCCTCCCTATAGTGAG
GenBank Accession BX649784 [GenBank]
Graphic View Graphic view of gene At5g11060
Predicted Position of Insertion Chr5:3511298 - go to primer design
BLAST e Value 1e-56
Hit Clone Code (BAC ID) T5K6
Hit Gene Code At5g11060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox protein knotted-1-like 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03