SimpleSearch - Line and FST details


Line specific information

 
Line ID 224B12
Vector Used pAC161
Line Availability only available from NASC (N421432)
Segregation Analysis 100:91:81
Confirmed for Hit FCAALL
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g50890 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g50890

 
Sequence (A. th genome BLAST matches underlined)
>11-K020163-022-224-B12t-8409
ACTGTTTGTATGATTTCCAGGTGGTGGTATCTATTTTTTCTAGAGAGAGGGGTAAGCTAA
GGTGTGCTATGGATTCTTAGATATAGTGAGATCTGATGATTAAATTTGATATATACTGAA
TGGGAGGCTGAGTAAAGTGAGAGTATGGGATGTTCCAAAAAAGAGGGAAATACGTGTGTT
TTTATTAGTTAAATGGACAAGTATGGCTAAAACGTTTAGCTGGAATAGCTCAGGTGGTTA
GAGGGTGTGGCTGTTAACAAGAAGGTTGGAGGTTCGACCGGTATTCTTATGGGATGATCG
AACAAAAAGAGTGGGGGGTGATCAGAGGTTTTTTTTTTTTTTCCCCCCCCCCCCTTGAAA
TGAGGATTGGACGAAAAAAAAAGGAGGGGGGGGGGGGGTGTATGAATGGTGATGCTTTAT
GAGGTGTGTCGTTTGGGGGTTGTTAGGGTCTGGCGCAGAGCGGTGATATGTGGCGAGGCA
GGGTGTTGTGGGATGTAGAAGACCCGAAGTTGAGGTGGCGAGGGGGCTACTTTATTTTTA
TGACTGAGTGATGTGGCGGGGGTGAGGAGTGGTTTGGATGGCTTGTTTGGTTGAGTTTGT
GTGCGAAGTTGTCAGCGGCGCGGGTGTGATGCATGCAATGGAGACAGCGAAGGGGGTAGA
GAGGAATAGAGGGCGAGGGTAGTTGTGGATGATGTTAGTTAGGAGATAGGGTTGAGTGCG
TTGGTGGTGCTCCGTGGGCGAGGGTGATTGTGTGTGGGTACGTAGGCGGATATTGTGCGG
GTAAGTGTAGTGATGTGTCTGTGTCTGTTGATATGGTAGGGGGGTAGGGCGCATAGGGAG
GATTGATGTGTTGCGGTAGGGTGTCGGAGAGTGTTATCGTAGTGCATGTCGTGGGGGTAG
CAGATGGGGTGGCGGGGTTGCGGGGGTCCGGTGTTGTAGTTGGTAGTTTCTAATTGTGTA
GCGTCGATGGCTCTGTGTGTTATAGTAATGAATTGTATATTTGAGAGGGGTGGAGAATGG
AGGTGATGA
GenBank Accession FR806061 [GenBank]
Graphic View Graphic view of gene At3g50890
Predicted Position of Insertion Chr3:18917115 - go to primer design
BLAST e Value 1e-20
Hit Clone Code (BAC ID) F18B3
Hit Gene Code At3g50890 [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox protein 28
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 326G12

Gene hit FCAALL

 
Sequence (A. th genome BLAST matches underlined)
>90-K014242-022-224-B12-8409
ATTGATCCATGTAGATTNTCCCGTACATGAANGCCTTTACAGGNTTAATATTAATACATC
TTAAATCTCATTATTAATTTAGCAGTATACGCCTCTACACTATTTCGAAAATCGGAAGCT
CCAGCCTCCAGGGACTACTTCAGCTATGGTTTCAGTCGAGACGCAACTCCTATGGGATCC
TCCCTATAGTGAGANNNNNNNNNNNNGNCNCCCNNNNACNNTNGNNNCNACTNNNNNCTA
NNATCTACTGCCCTGCGAAAATGCCTACACAAACANAAAAAAACAAATGATCTCAAGTTA
TATCCACATGTAGCAACTGGTGGATCTACTCGAAAATAGATATTTCAAACTTCAATGAAA
CGATGGCCAAAGCATATGTCAGAACTTTAAAAGACATATTATATTATAATTGTAGATAAA
ATTCTGTCTTTTTCTAACCAATATATTTGCCTAAAAATTGGTTCAAAACCCAACAGAACA
AATTAATTTAAATATCGATTTCGGGCTGCTCCAAGTACGTATTATTTTAATCTGGACGAA
CTTGGACGATTTAGGAAAAACGAG
GenBank Accession AL768059 [GenBank]
Graphic View Graphic view of sequence AL768059 of line 224B12
Predicted Position of Insertion Chr4:9422527 - go to primer design
BLAST e Value 2e-129
Hit Clone Code (BAC ID) FCAALL
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23