SimpleSearch - Line and FST details


Line specific information

 
Line ID 224D07
Vector Used pAC161
Line Availability only available from NASC (N421451)
Segregation Analysis 100:81:73
Confirmed for Hit At4g16210
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g16210

 
Sequence (A. th genome BLAST matches underlined)
>52-K014238-022-224-D07-8409
CTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACACTTGAATATATCCTGTCCTAC
TGTATATAAAACCCCGATCGTATTATGCGAGAATTCGTTCTTTGTGTTCGCGAATCGCCG
AAAAATGGATCAAACAGTATCGAAAAATCTGATTACAGTGAATGACCGAATCGGGCGGGA
TCGCCAGTGCATCACAATCATCCGATCGTACTTTATCAATTCACTCACGAGAGCGATGAT
GGTTGATCTCGCCAAGGCATTCAAGGATATGGACTCCCACGAATCGGTCCAGGTCGCGAT
TTTCACCGGATCAGGTCGATCTTTCTGCTCTGGCGTTGATTTGACTGCGGCGGAGTCTGT
CCTCAAAGGAGACGTGAAGGATCCGGAAACCGACCCGGTTGTGCATATGGAGCGGTTGCG
TAAACCGGACATCTGACCTATTAACGGTTTTACCTTCACCGACGAGTGTGAGCATCGCTG
AGCCTGCGATATTTTGTGCCATTATGTGGGATCCTGCCTTTGCCCAGGANCCGCGGGAAC
CGGAGCTGAATGAACCCATACCANACGACGAGGCGTGAACCACGATGCCTGTAACAGTGG
GCCCAACGTTCCCCAGACTATTAACTGGCGAACTACTTAGTCTA
GenBank Accession AL768080 [GenBank]
Graphic View Graphic view of gene At4g16210
Predicted Position of Insertion Chr4:9178044 - go to primer design
BLAST e Value 2e-117
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g16210 [TAIR] [MIPS] [SIGnAL]
Gene Annotation enoyl-CoA hydratase/isomerase A
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR396421 [GenBank] CR396420 [GenBank]


Last Updated on 14.10.2014 10:23