SimpleSearch - Line and FST details


Line specific information

 
Line ID 225G05
Vector Used pAC161
Line Availability only available from NASC (N421581)
Segregation Analysis 50:40:38
Confirmed for Hit At1g74640 At3g01920 At4g31420
Parent of DUPLO pair 2394
Parent of pair(s) none

Gene hit At1g74640

 
Sequence (A. th genome BLAST matches underlined)
>39-K014239-022-225-G05-8409
TTGATCCATGTAGATTTCCCGAACATGAAGTCCTTTACAATTGAATATATCCTGTCCACA
GTCTCTCTGTAGCTATGGGATCCTCACCTATAGTGAGAAACAGCTGCCTCTCACAAAGTT
TCGTCTCATCACCGACGCAAGATGTTCGCGAGACACATGAACGCGCGAGTTACCATTCAA
ATGACAGGGCACAAGAGCTGACCGCCCTGCGCTTGGACATTGTGCTTGAGCCCCTCCGAT
TTGTCGAGAACGTTACATTCTTCTTGGTACTTGAACTTCATGTTACACGCGTTACATGTT
AAACCAGGCATCTTCTCTCCTTCAATATCGATCGATTCTATGGGATCCTCCCTGTAAGAG
AGANNCTGAANCAGCCATGGAAGCGAAATTATACAAAAAATTACGGTTTTTCGAAGATCT
GAAGCGAGAAAGACCGAAACGACGATTCAAAGGTCGAGACTTTTGAACCAGAACCACGAA
GACGTGCTTGATATTCCTCGTCCAAGTTTGGGAGAGTCTGTCAGAAATTTACAACTACAG
CCCCAACACAATTTCGTATATT
GenBank Accession AL761470 [GenBank]
Graphic View Graphic view of gene At1g74640
Predicted Position of Insertion Chr1:28033168 - go to primer design
BLAST e Value 9e-70
Hit Clone Code (BAC ID) F1M20
Hit Gene Code At1g74640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g01920

 
Sequence (A. th genome BLAST matches underlined)
>56-K118628-0022-225-G05C-8409
CATTTACAATTGAATATTCCTGTCCGGACATGAAGCCATTGGTAAATAATGACAGTGTGA
AAGGGCCTAAAGAAAATGAATGGATGATCGACCCAACCGCAATAGGTGACATATATGGAC
CAGAGGTATTTATAGCTCTCACTCTTTCTCAGCGACTAAAGAACATCTTTGGTTGCTCTA
TTCTCTGTTTCGGTTTCCTTTTACAGGGTCTGGATTTTGTGGTAGACGGAGGTATACGAG
TGGCTGAACCATCCACCATCGTGGATATGACAGGACCATATCCCAAGGTCATAAGGGAAG
GGAAGGTAATATATTATCTAAACATTCTGTGCTTCATCCATCCAAGGACCTTAACTTGAC
CGTGTGGTTGGTTTGTATAGGGACCT
GenBank Accession HG968830 [GenBank]
Graphic View Graphic view of gene At3g01920
Predicted Position of Insertion Chr3:318583 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F28J7
Hit Gene Code At3g01920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DHBP synthase RibB-like alpha/beta domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL761471 [GenBank]

Gene hit At4g31420

 
Sequence (A. th genome BLAST matches underlined)
>39-K014239-022-225-G05-8409
TTGATCCATGTAGATTTCCCGAACATGAAGTCCTTTACAATTGAATATATCCTGTCCACA
GTCTCTCTGTAGCTATGGGATCCTCACCTATAGTGAGAAACAGCTGCCTCTCACAAAGTT
TCGTCTCATCACCGACGCAAGATGTTCGCGAGACACATGAACGCGCGAGTTACCATTCAA
ATGACAGGGCACAAGAGCTGACCGCCCTGCGCTTGGACATTGTGCTTGAGCCCCTCCGAT
TTGTCGAGAACGTTACATTCTTCTTGGTACTTGAACTTCATGTTACACGCGTTACATGTT
AAACCAGGCATCTTCTCTCCTTCAATATCGATCGATTCTATGGGATCCTCCCTGTAAGAG
AGANNCTGAANCAGCCATGGAAGCGAAATTATACAAAAAATTACGGTTTTTCGAAGATCT
GAAGCGAGAAAGACCGAAACGACGATTCAAAGGTCGAGACTTTTGAACCAGAACCACGAA
GACGTGCTTGATATTCCTCGTCCAAGTTTGGGAGAGTCTGTCAGAAATTTACAACTACAG
CCCCAACACAATTTCGTATATT
GenBank Accession AL761470 [GenBank]
Graphic View Graphic view of gene At4g31420
Predicted Position of Insertion Chr4:15247511 - go to primer design
BLAST e Value 2e-33
Hit Clone Code (BAC ID) F8F16
Hit Gene Code At4g31420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Zinc finger protein 622
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03