SimpleSearch - Line and FST details


Line specific information

 
Line ID 227F02
Vector Used pAC161
Line Availability only available from NASC (N421758)
Segregation Analysis 150:119:95
Confirmed for Hit At4g28800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g28800

 
Sequence (A. th genome BLAST matches underlined)
>14-K014262-022-227-F02-8409
TTTGATCCATGTAGATTTGCCTGACATGANNGCCTTTACACTTGAATATACTCCTGACAC
ATGCCCAGATGACACGGACCGAGCATCTCATATGCTGCGTGCATGCCCGCTATCTCAGAC
TTGCGTGGCCCTCTGTAGCTGGGTGACGCACGATTCGGCGGCACAATAAGAAGGGGGGGA
CTGGTCAATGCCTATCTGTCTCACATGAATGACACCCGAAGGCGACGGTCCGACTGTTTA
AACTTTACCACCAGACAATGTGTTGGCTCTTAGGCACTAGGATTTTGTAAAGTTTTCCGC
CCTGCTCGTGGCGATAGTCTGACGTGGTGCCACACAGATGGAACTTTGCGGCTGAGCACC
CCGAGTGGAGTTGAC
GenBank Accession BX890894 [GenBank]
Graphic View Graphic view of gene At4g28800
Predicted Position of Insertion Chr4:14222583 - go to primer design
BLAST e Value 5e-25
Hit Clone Code (BAC ID) F16A16
Hit Gene Code At4g28800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX890894 [GenBank]


Last Updated on 31.08.2016 09:40