SimpleSearch - Line and FST details


Line specific information

 
Line ID 227G05
Vector Used pAC161
Line Availability only available from NASC (N421773)
Segregation Analysis 100:91:84
Confirmed for Hit At5g43290
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g63290

 
Sequence (A. th genome BLAST matches underlined)
>39-K014262-022-227-G05-8409
ATTATTAAAAGAGTATTTTGAACGCGCCCCCCTCCCGATTATACCAGCTATTAACCTGGG
GCACGGCTATCTATTAGATTGCAGACCATTCCCTCCGTAGTACTGCTTTGTCGTTTGACG
TGAGAACTCGGCACAAATCATCCCATCCCTT
GenBank Accession FR806132 [GenBank]
Graphic View Graphic view of gene At3g63290
Predicted Position of Insertion Chr3:23383433 - go to primer design
BLAST e Value 9e-42
Hit Clone Code (BAC ID) F16M2
Hit Gene Code At3g63290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At5g43290

 
Sequence (A. th genome BLAST matches underlined)
>39-K014266-022-227-G05-8409
CTGATCCATGTAGATTATCCCGGACATGAANGCCTTTACAATTGAATATATTCAATCCTG
ACAGTACTTTGAGCAGCGAGGATAGGTACACTTCTAAAGGTGAAGAACAATAGTACTGGA
ACTGTGTGATGATGGACTACAAACGGAGACAATATGGCCAAAAATCACTCAAAAATAGCC
CTAACCCACGGTACATATGTGCATTCTGCAGATTAGAATAGTGTATGCATATCGAACTTC
TTTGGATCGGCCAAAATGATACGTCTTAAAATCAACATATGGAAGTCCTATTTATTATAC
TTAGCTATCGGCTCACAAGCCTAATGTTACTATATTTGTGATATATGCCTATGGGATCCT
TCCTTTAACGAGTATTTTGAATTTAACTACCTAAAGATTAGACAAGCTATTAACCTGGCG
CACGGCTATCTATCAGATTGCAAACCATTCCCTCCGTAGGACTGCTGTGTCGCTTCACGT
GAAAACTCGGCAAAAGTCATCCCATCCCTTAACCCCGACGATAGAGGTGCAACCATATTC
TGGTAATCTGG
GenBank Accession BX649789 [GenBank]
Graphic View Graphic view of gene At5g43290
Predicted Position of Insertion Chr5:17372700 - go to primer design
BLAST e Value 3e-88
Hit Clone Code (BAC ID) MNL12
Hit Gene Code At5g43290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 49
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40