SimpleSearch - Line and FST details


Line specific information

 
Line ID 227H06
Vector Used pAC161
Line Availability only available from NASC (N421786)
Segregation Analysis 100:98:88
Confirmed for Hit At3g17220
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g17220

 
Sequence (A. th genome BLAST matches underlined)
>48-K014262-022-227-H06-8409
CTCTGTTCGGCAGGTATGCTGCCATCTTTGCTTCTTTCTTTCTTATGTTCGTTGGTAGAT
GATGGTTAAGTTATTCCCTTACTATGCCTGACTATTCATATTTATAGATGCATGCGATTG
ATTGCTTCCGCTATGGGATCCTCCCTTAAGTGAG
GenBank Accession AL761730 [GenBank]
Graphic View Graphic view of gene At3g17220
Predicted Position of Insertion Chr3:5883713 - go to primer design
BLAST e Value 2e-64
Hit Clone Code (BAC ID) MGD8
Hit Gene Code At3g17220 [TAIR] [MIPS] [SIGnAL]
Gene Annotation pectin methylesterase inhibitor 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23