SimpleSearch - Line and FST details


Line specific information

 
Line ID 228D04
Vector Used pAC161
Line Availability only available from NASC (N421832)
Segregation Analysis 100:39:35
Confirmed for Hit At1g29280
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g29280

 
Sequence (A. th genome BLAST matches underlined)
>28-K014263-022-228-D04-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGGAATG
GCTATCCGCGTGCTGAGCTAGATCGCAACGTGTGACCCCACTACGCTAGTTCTGTGACTA
AACATCACAAAGCACTCCGGCAACTCGCCGAGATCGGCGACCGACTACTGTCCTGATTCT
CCCATGGCAAAACGAACACCGGCGCGGCCTCAGCCCCCGGCACGGCCGTCTTTATCTCCG
ACGAGAAAAGCGGGCTCTCAAGAATCGTAGAAAATGATGTCTCCATCTCCGTAAACCATG
CGGAACTCGTCGACACATGATGGCGTCGTTTCATTCCCACTTCCAGAAACCATAAACTTA
TTATCCTGCTACTACGCCTGTGGCTCTACCTCAGGCTCAGGTTCGGGTCTGGGCTCAGGT
TTACGTTTAGGCCCGTTTCTTGTGGAAGAAGTGAGAGGCCAAGGATGGTCATGCTCAAAA
GTGTAAGTGATGAGAATCATCGTTGGATCATCTCTGCTTCTCTCGACTTGGTTTCTCGCC
GGACAACCTTTTGTGCTACTACAACGGGACTACCCTCTATGGGAT
GenBank Accession BX649790 [GenBank]
Graphic View Graphic view of gene At1g29280
Predicted Position of Insertion Chr1:10237483 - go to primer design
BLAST e Value 1e-155
Hit Clone Code (BAC ID) F28N24
Hit Gene Code At1g29280 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 65
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03