SimpleSearch - Line and FST details


Line specific information

 
Line ID 229E02
Vector Used pAC161
Line Availability only available from NASC (N421938)
Segregation Analysis 88:32:20
Confirmed for Hit At5g12870
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g12870

 
Sequence (A. th genome BLAST matches underlined)
>18-K032733-022-229-E02C-3144
TCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGAC
AGGTTACCCGGGGATCAGATTGTCATTTCATTTATCTAAATTATCATTGGTAATTACTCT
TTCTTTTTCTCCATGTTGGTTTGTATGTGGGTCAAGGAAGGGTTGACGAAGCCTTGTTCT
TGTAAGGACATGAAGCTTCCTATAATGTCTTTAATATCCAAAGAAGATGCGGAATTAGAA
GAGGAATCGCTTGCTGTGTTGGGTGATGAGGATGAGTTGTTGATTAAGTTGGAGGTATCG
GACATCTTCTTTAGCCTTTTCTTTATTGTTGAGTTCCAGAAATTCTTGATCTCGTTATCG
GTCCGACCAGGCAATCGTGCTGCAATCTGAGACCACCTATGAAATCGAAGAATAAGAGAG
TAGAATAGTTTAATGAGATGATGTTATGTAAAATGTATACCAGTGCATGGTTTGCATGGG
AATTAGAGAGTGATCCGTTCTTCAATGTT
GenBank Accession HG968833 [GenBank]
Graphic View Graphic view of gene At5g12870
Predicted Position of Insertion Chr5:4063238 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T24H18
Hit Gene Code At5g12870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 46
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL937913 [GenBank] HG968833 [GenBank]


Last Updated on 31.08.2016 09:40