SimpleSearch - Line and FST details


Line specific information

 
Line ID 230B04
Vector Used pAC161
Line Availability only available from NASC (N422000)
Segregation Analysis 156:120:98
Confirmed for Hit At5g63120
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g63120

 
Sequence (A. th genome BLAST matches underlined)
>26-K014312-022-230-B04-8409
CTGATCCATGTAGCATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTAGTACG
TGAACTGTTTGTTCTCTACTACAAAGATCGTTCTATGGGATCCTTCCTATCTGTTGAGTT
AATTCTATCAACTAAATACACTTTACTACTTTACTCTCAAGTCAACCGTAACACTGTAAT
GAAACTTGTTTTTAAAAATCGGATGTGGATTATTAGGTTGGGAGATTCAAGTATTGCGAA
TAGAATTTAGACAAATGTAAGCATCTATAACATCTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR770295 [GenBank]
Graphic View Graphic view of gene At5g63120
Predicted Position of Insertion Chr5:25318844 - go to primer design
BLAST e Value 4e-84
Hit Clone Code (BAC ID) MDC12
Hit Gene Code At5g63120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR806186 [GenBank]


Last Updated on 31.08.2016 09:40