SimpleSearch - Line and FST details


Line specific information

 
Line ID 230D10
Vector Used pAC161
Line Availability only available from NASC (N422030)
Segregation Analysis 50:31:28
Confirmed for Hit At1g13260
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g14030

 
Sequence (A. th genome BLAST matches underlined)
>76-K014316-022-230-D10-8409
CGGAAGTGCCGTTCATGGTGNGTTACAAGAAAGCCACTCTCAACAGGCTCAAATCTGGCG
CCGAACGCGCCTCCGTTTCCTACGACATCTATAACCAAGGATCCTNGTTAGCTCTCTATC
C
GenBank Accession AL762042 [GenBank]
Graphic View Graphic view of gene At5g14030
Predicted Position of Insertion Chr5:4526654 - go to primer design
BLAST e Value 7e-49
Hit Clone Code (BAC ID) MAC12
Hit Gene Code At5g14030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocon-associated protein beta (TRAPB) family protein
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At1g13260

 
Sequence (A. th genome BLAST matches underlined)
>76-K014312-022-230-D10-8409
AGCACACGTATACTATACACAACATAATTATCAACACAACACAAACACATTTGTGTTTTC
TCCATTGTTTCAAACATAAAAAAAACACAGATTAAATGGAATCGAGTAGCGTTGATGAGA
GTACTACAAGTACAGGTTCCATCTGTGAAACCCCGGCGATAACTCCGGCGAAAAAGTCGT
CGGTAGGTAACTTATACAGGATGGGAAGCGGATCAAGCGTTGTGTTAGATTCAGAGAACG
GCGTAAAAGCTGAATCTATGGGATCCTCC
GenBank Accession CR770303 [GenBank]
Graphic View Graphic view of gene At1g13260
Predicted Position of Insertion Chr1:4542270 - go to primer design
BLAST e Value 3e-106
Hit Clone Code (BAC ID) T6J4
Hit Gene Code At1g13260 [TAIR] [MIPS] [SIGnAL]
Gene Annotation related to ABI3/VP1 1
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23