SimpleSearch - Line and FST details


Line specific information

 
Line ID 232H12
Vector Used pAC161
Line Availability only available from NASC (N422272)
Segregation Analysis 100:96:64
Confirmed for Hit At4g27800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g66510

 
Sequence (A. th genome BLAST matches underlined)
>96-K014314-022-232-H12-8409
TTGATCCATGTAGATTNTCCCGGACCATGAAGCCTTTACAATTGAATATCTCCTGACTGC
TCTGATTTGCCCACATTGAGATTTCATCTATTTCACTGCATTAGCTCTATTTTAGTACAT
GACCAAGATGAACTGATCCGTATCTATGTGGTAAGACTTACTGCGCAGCTAGATACCGTA
TGAGCGATGCATAGGAAACACTCATTTCTGAGTGTATATTGCAGTGGCCTGTGGAACCTG
ATTCATCTTCATCGTCGCCGGTATCTTGTATGGGATCCTCCTTCTATAGAGCCATTCGAA
TCCTGGTGATGATTTTTTTTTGTTTCATTACTCGTCGGGTCTTCGAAATGTTTGTGTATT
TCTCTGGAATCAGGTCATAGTTTTGATTGATGCGTTTCCTCTTATGTTGATGATTGATTA
TGGCATTTTTGATTANAAACCTTAGAGCTTAAGATCAAATGTTCTTCATTTTGCTATGGG
ATCCTCC
GenBank Accession AL938169 [GenBank]
Graphic View Graphic view of gene At5g66510
Predicted Position of Insertion Chr5:26551579 - go to primer design
BLAST e Value 3e-82
Hit Clone Code (BAC ID) K1F13
Hit Gene Code At5g66510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation gamma carbonic anhydrase 3
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At4g27800

 
Sequence (A. th genome BLAST matches underlined)
>96-K014318-022-232-H12-8409
NTTTGATCCATGTAGATCTTCCCGTACATGAANGCCTTTACAATTGAATATCAGTCAATT
CCTCGATTTGCCCAGATCGAGATAAGACCTATTTCAATGCATTAACAAGACTTTAGACAT
GACCAAGTTACAATGATCCATTTATAAATAAGAAGACTTACTGCACACGAATCACCAATA
TGAGCAATGAAGGAAACATCATTTCTGATGATCATTACAGTGGCTGTTGAACCTGATTCA
TCTTCTTCGTCACCGTTAGCTCCTATGGGATACTCCCACTTCGGTGAGGAATCACTTCAT
TTCACTCAAAATCATCAAAATTCATTCAAGCTCTGAGAAATTTAAGCTCATTTTCACCAT
TTGAGCAAATTGCGGCCAACGCTTTCAAAGGCCTTAATCAAAGCTTCCTTGATTGCTGCG
AAATCGCCTCCATTCAACAACGATCCAGCTTGCAATGCACCAACACACTCTNTATACAGC
TCTTCCCTATCAATCATCATCACCATCGTCAACACTTATACCCTATGGGATCCTC
GenBank Accession BX942896 [GenBank]
Graphic View Graphic view of gene At4g27800
Predicted Position of Insertion Chr4:13853268 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T27E11
Hit Gene Code At4g27800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation thylakoid-associated phosphatase 38
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03